PCR analyses BI 2536 mouse of fhu locus distribution in H. influenzae Primers were designed for use in the polymerase chain reaction (PCR), based on the available sequence of the fhu gene cluster in NTHi strain R2846, to survey for the presence of the five genes comprising the locus. The sequences of the primers comprising each of the five primer pairs are shown in Table 3. PCRs were performed in a 50 μl volume using 100 ng of the appropriate chromosomal DNA as template, and the reactions contained 2 mM MgCl2, 200 μM each deoxynucleoside triphosphate

(New England Biolabs), 10 pmol of each primer and 2 U of FastStart Taq DNA Polymerase (Roche, Indianapolis, IN, USA). PCR was carried out for 30 cycles, with each cycle consisting of denaturation at 95°C for 1 min, annealing for 1 min at the appropriate temperature and primer extension at 72°C for 1 min with one final extension of 30 min. Annealing temperatures were 58°C for the primer pair directed at fhuA and 57°C for the other four primer pairs. Table 3 Primers

used in PCR survey for presence of fhu genes Primera Sequence 5′ to 3′ R2846.1773(fhuC)_F GGTTCGATTTCGTTGGACG R2846.1773(fhuC)_R GACGATTTGCTGTGCGTC R2846.1774(fhuD)_F CAGTGGGCGATATGCAAAG R2846.1774(fhuD)_R GTTTGGCGAGTTCGGTG R2846.1775(fhuB)_F GCGCAAAACCATGTCGC R2846.1775(fhuB)_R GTCGGGAAACTGAGTTGC R2846.1777(OMP)_F CGTCACTTTATCCAGCATCAG R2846.1777(OMP)_R GATAGCGTATCGGAAGC R2846.1778(orf5)_F GCTTAGCACGCAGTACG R2846.1778(orf5)_R CTCCTCTGTGTATTAAATTCC a Primer pairs used to assay for each gene. Construction of fhuD insertion mutants An insertion mutation of fhuD was constructed as follows. Torin 1 supplier A pair of primers was designed for use in the PCR, based on the available NTHi strain R2846 genomic sequence, to amplify

an 848-bp region internal to the fhuD gene. Primers were designated FhuC-dnA and FhuC-dnB and had the respective sequences 5′-GGATCCCACTGCTCGGAATGACC-3′ fantofarone and 5′-AAGCTTCGTGCAGTAAGCCATCG-3′ (those portions of the primers shown in boldface represent find more restriction sites engineered into the primers for directional subcloning; the engineered restriction sites were not utilized as part of this study). The PCR was performed as described above using 100 ng of strain R2846 chromosomal DNA as template and with annealing for 1 min at 54°C. PCR products of the expected size were obtained and were successfully cloned into the TA cloning vector pCR2.1-TOPO (Invitrogen). Cloned amplicons were confirmed as correct by automated DNA sequencing, and a plasmid harboring the correct insert was designated pDJM385. The spectinomycin resistance marker from pSPECR [69] was excised with Cla I and cloned into the unique Cla I site (beginning at nucleotide 615 of the cloned 848-bp) of pDJM385 to yield pDJM386. Competent H. influenzae were transformed to spectinomycin resistance with pDJM386, using the static aerobic method as previously described [70], and selected on sBHI agar containing spectinomycin.