To confirm the generation of Tregs, we performed transfer www.selleckchem.com/products/PD-0332991.html experiments: CD4+ cells were isolated from PBMCs. One half

of the cells were differentiated into Tregs by co-stimulation with different APC types for 6 days. The other half was frozen at −80°C. On day 6, T cells from cultures were separated in CD25+ and CD25- cells. They were added at a ratio of 1:10 or 1:30 in 96-well flat-bottom plates to thawed CD4+ T cells, which were labeled with CFSE. Afterwards, the cell mixture was stimulated with activation beads. Cell proliferation was measured after 5 days by flow cytometry. For CFSE-labeling cells were incubated 10 min at room temperature in 0.3 μM CFSE/PBS (MolecularProbes, San Diego, CA, USA) and thereafter intensively washed. Cells were analyzed on a FACS Canto (BD). CD1a, PD-L1, CD14, ICOS-L1, PD-L2, B7-H3, B7-H4, CD80, CD86, MHCII CD40 and CD252 were stained at the cell surface. Therefore, cells were washed in PBS and stained directly with FITC, PE or APC-labeled antibodies. Overlays were done with the Weasel

v2.5 software (WEHI, Melbourne, Australia). FoxP3 expression in T cells was assessed using an anti-human FoxP3 Staining Kit (e-Biosciences, San Diego, CA, USA), including corresponding isotype controls. Cell-free supernatants were harvested and analyzed for IL-6, IL-12p40, IL-10 and TNF by commercial available ELISA kits (OptEIA; BD). About 8×106 cells were stimulated and subsequently 4-Aminobutyrate aminotransferase lysed in RIPA buffer (50 mM Tris-HCL, pH7.4; 1% Igepal; 0.25% sodium deoxycholate; 150 mM NaCl; 1 mM EDTA; 1 mM

PMSF; CP-690550 order 1 μg/mL each aprotinin, leupeptin and pepstatin; 1 mM Na3VO4; and 1 mM NaF). Lysates were cleared by centrifugation at 4° for 20 min at 14 000×g. Equal amounts of the lysates were fractionated by 12% SDS-PAGE and electrotransferred to nitrocellulose membranes (Whatman Protran nitrocellulose membrane; neoLab, Heidelberg, Germany). The membranes were blocked with TBS/0.05% Tween-20/3% BSA and were blotted with the indicated antibodies. Detection was by enhanced chemiluminescence (ECL; Perkin Elmer, Groningen, Netherlands). For the analyses of the un- and phosphorylated proteins the same lysates but different membranes were used. The ChIP assay was carried out as described by Natoli and co-workers 50 modified by Bode et al. 51. One-twentieth of the immunoprecipitated DNA was used in quantitative PCR. Results were shown as percentage of input. STAT-3, STAT-1 and STAT-5 antibodies used for ChIP were acquired from Santa Cruz Biotechnology. The following primers were used for DNA quantification: PD-L1 promoter fw TGGACTGACATGTTTCACTTTCT and rev CAAGGCAGCAAATCCAGTTT. The comparison of two data groups were analyzed by Student’s t-test. We appreciate the discussions and help of Dr. K. Kubatzky and Dr. K. A. Bode and the help of Judith Bauer. This work was supported by the Collaborative Research Center (SFB) 405 (Bartz/Heeg).