‘s recommendations. RNA was purified twice with Tri Zol and then executed with ethanol Filled and resuspended in 0.1 mM EDTA. ADX-47273 The concentration is judged determined by a spectrophotometric measurement and the integrity t of RNA by analyzing samples on an agarose gel. Northern blot. For Northern blotting, 5 � �g the RNA was analyzed by on a 1% agarose gel with 6% formaldehyde in 1 EUR � �� �M OPS gel St. The RNA was transferred to a Hybond N membrane by capillary blotting and fixed by UV irradiation. The filters were prehybridized for at least 30 minutes to 42 in 10 ml of ULTRAhyb and hybridized overnight at 42 after the addition of another 5 ml ULTRAhyb with 32P-labeled probe. The membranes were washed twice for 5 minutes in 2-42 washed � �� � �� SC, 0.
1% SDS with two points of 15 minutes, followed in 2 � �� � �� SC, 0.1% SDS, 1 15 minutes in 0, 2 � �� � �� SC, 0.1% SDS, an XL880 d a period of 15 minutes in 0.1 � �� � �� SC, 0.1% SDS at 42nd The transfer has been developed and then quantified by a phosphoimager. The Gr S of mRNA were determined with reference to 18S and 28S ribosomal RNA by F were Dyeing membranes with methylene blue. The membranes were removed by boiling 0.1% SDS before rehybridization. The cDNA probes for hBD 3, NGAL and SLPI have been described above, and the probe for G3PD was from Stratagene. IHC. Slices of skin were in 10% formalin, fixed dehydrated and embedded in paraffin. Sections of 5 � �� thickness were on polylysine-coated glass slides hunter set, deparaffinized in xylene and rehydrated in graded alcohols.
The Objekttr hunters were then incubated for 15 minutes in 0.05 M Tris trypsinized with 0.5 mg / ml trypsin and 0.5 mg / ml CaCl 2 or treated with Dako antigen-retrieval-L Solution for 40 minutes at 97th The Objekttr hunters were incubated in a 1:1000 dilution of rabbit polyclonal antibody Body against NGAL and SLPI and a 1:666 dilution of rabbit polyclonal antibody Body against hBD third The Antique Body were diluted in TBS with 1% BSA, 5% goat serum, 0.05% Tween 20 and 0.01% thimerosal, and the Objekttr hunter were incubated for 24 hours at room temperature. After 3 washes of 20 minutes in TBS with 0.05% Tween 20, were the Objekttr hunter incubated with alkaline phosphatase conjugated goat anti-rabbit IgG diluted 1:1000 in the same buffer as the first antibody Body and 24 hours incubated by three washes of 20 minutes.
The color was developed with Fast Red chromogen in Tris buffer, and the Objekttr hunters were matoxylin with barbed-Harris H. Real-time PCR. CDNA was synthesized from 200 ng iScript purified RNA using the cDNA synthesis kit according to manufacturer’s instructions. hBD 1, hBD 2 and 3 with G3PD expression of hBD iQ were analyzed using SYBR Green Supermix. The primers are: hBD 3: 5 3 CTTCTGTTTGCTTTGCTCTTCC � � �� � �� ND 5 3 CACTTGCCGATCTGTTCCTC � � human G3PD: 5 3 TGGTATCGTGGAAGGACTC � � �� � �� ND 5 3 � � AGTAGAGGCAGGGATGATG � TGF 5 � CTGGCTGTCCTTATCATCAC 3 � �� � �� ND 5 � AGCGGTTCTTCCCTTCAG 3 � HB EGF: 5 3 TGCCAAGTCTCAGAAGAGG � � �� � �� ND 5 � GGAGTAGCACCAGAAGAATG 3, Amphiregulin: 5 GTCTCCACTCGCTCTTCC � � �� � �� ND 3 5 3 GGGCTCTCATTGGTCCTTC � � MBD 14: 5 3 GTATTCCTCATCTTGTTCTTGG � � �� � �� ND 5 3 AAGGCAGTTAAGTACAGCAC � � murine SLPI: 5 3 ACGGTGCTCCTTGCTCTG � � �� � �� ND 5 3 GTACGGCATTGTGGCTTCTC � � 24p3: 3 5 AGGACGACAACATCATCTTCTC � � �� � �� ND 5 3 TGGAGTGGCAGACAGACAG � � and mouse-actin �: 5 ACCCACACTGTGCCCATCTA 3 � � �� � �� ND 5 3 CACGCTCGGTCAGGATCTTC � � The amplification was carried out at 58 to 40 cycles iCycler