012). On univariate analysis of our data, several clinical factors including AFP, tumor multiplicity, tumor size, vascular invasion and TNM stage showed prognostic significance for both OS and TTR (Table 2). Then, significant clinical

factors were used for further multivariate analysis. Tumor number, tumor size and TNM stage were demonstrated to be related with OS (P < 0.001, <0.001 and =0.004) and TTR (P = 0.001, <0.001 and =0.015), respectively. While vascular invasion was an independent predictor for OS (P = 0.037). Furthermore, combination of intratumoral IL-17RE and IL-17 densities showed higher predictive value on outcome of HCC patients by multivariate (Table 2) and predictive accuracy by ROC analysis (Figure 3) than either factor alone. To analyze the prognostic buy Small molecule library capacity of these biomarkers for early recurrence (metastasis after surgery ≤24 months) INCB024360 datasheet and late recurrence (new primary lesion after surgery

>24 months) [4], Kaplan-Meier method was performed. Combination of intratumoral IL-17RE and IL-17 densities were found to be more likely to suffer from tumor early and late recurrences by univariate and multivariate analysis (Table 3). In addition, peritumoral IL-17RE density also showed the predictive power in OS and TTR (Figure 2). Figure 3 Receiver operating characteristic analysis based on (a) overall survival and (b) time to recurrence of 300 HCC patients. Peritumoral IL-17RE expression (AUCTTR = 0.646, P < 0.001; AUCOS = 0.688, p < 0.001), intratumoral IL-17 expression (AUCTTR = 0.611, P < 0.001; AUCOS = 0.581, p = 0.023), peritumoral IL-17 expression (AUCTTR = 0.476, P = 0.474; AUCOS = 0.477, p = 0.509), intratumoral IL-17RE expression (AUCTTR = 0.646, P = 0.005; AUCOS = 0.637, p < 0.001), combination of intratumoral IL-17 and IL-17RE expression (AUCTTR = 0.650, P <0.001; AUCOS = 0.681, p < 0.001), AFP (AUCTTR = 0.572,

P =0.031; AUCOS = 0.565, p = 0.066), tumor number (AUCTTR = 0.545, P =0.178; AUCOS = 0.549, p = 0.167), vascular invasion (AUCTTR = 0.557, P =0.087; AUCOS = 0.610, p = 0.002), tumor size (AUCTTR = 0.585, P =0.011; AUCOS = 0.659, p < 0.001), TNM stage (AUCTTR = 0.571, P =0.033; AUCOS = 0.612, p = 0.002). Table 3 Prognostic factors for early and late recurrence Factor Early recurrence Late recurrence   Univeriate next Multivariate Univeriate Multivariate   P HR (95% CI) P P HR (95% CI) P AFP(ng/ml)(≤20 v >20) 0.018 1.457(1.012-2.098) 0.043 NS   NA Tumor size(cm) (≤5.0 v >5.0) <0.001 1.799(1.272-2.544) 0.001 NS   NA Vascular invasion(yes v no) <0.001 1.472(1.032-2.101) 0.033 NS   NA TNM stage (I v II- III) 0.001 1.423(1.003-2.020) 0.048 NS   NA Peritumoral density (low v high) IL-17RE <0.001 1.604(1.129-2.280) 0.008 0.001 2.148(1.158-3.986) 0.015 Intratumoral density (low v high) IL-17RE 0.001   NS 0.007   NS Il-17 0.004   NS 0.034   NS Combination of IL-17RE &IL-17 <0.001 1.430(1.227-1.666) <0.001 <0.001 1.458(1.093-1.947) 0.

One such area of progress is the use and understanding of chlamydial recombination. There is considerable evidence for in vitro and in vivo recombination by chlamydiae, and the methods for generating chlamydial recombinants are becoming routine [4, 5, 24]. However, there remains a general lack of understanding regarding the cellular and molecular mechanisms associated with the process. The present study was initiated to address these challenges. We hypothesized

that an investigation of both the process of genetic recombination in chlamydiae and the correlation of specific chlamydial genotypes with phenotypes can be addressed using a combination of contemporary genome sequencing technologies with our ability to create genetic recombinants among chlamydiae. This approach has also been used by Nguyen and colleagues

[33] as part PD-0332991 purchase of a forward genetic strategy in these organisms, and the results of such experiments can be integrated with the recently developed chlamydial transformation system [3] to develop and validate correlations between gene structure and protein function. Evidence for recombination in chlamydiae was first provided by nucleotide sequencing of genes or genomes taken from a variety ALK inhibitor drugs of chlamydial strains. There are data in the literature suggesting that recombination hotspots might be present within or around ompA[7, 11, 12], and also at other locations in the genome [34]. Our genome sequencing has added some support for this premise, as the D(s)/2923 genome discussed by Jeffrey et al. [10] has a hybrid D/E OmpA sequence, and apparent recombination sites within this strain are at or very

near sites seen in other, independently isolated, clinical strains [9, 11]. Other investigators have proposed and debated the concept of chlamydial recombination hotspots using analysis of chlamydial genome sequences from laboratory-generated or clinical strains [8, 24, 35]. In the present study, we used two strategies to investigate Amrubicin the possible clustering of recombination events in vitro. First, we analyzed apparent crossover sites by genome sequencing of 12 recombinant genomes, which led to the identification of a total of 190 primary recombination sites. The largest integrated fragment identified in these experiments was over 400,000 base pairs, which constitutes approximately 40% of the chlamydial genome. The long recombined region observed in these progeny strains are consistent with the original observations of Demars and Weinfurter [4], who discuss very large exchanges in their recombinants. Sequence data from clinical isolates do not provide evidence for such large exchanged fragments, but there is clear evidence of recombined regions of greater than 50,000 base pairs [6, 10, 35].

pestis, as in many other Gram-negative bacteria, is a central transcriptional regulator responding to the cellular iron status [20, 50], as indicated in the schematic of Figure 5. Many iron uptake systems are transcriptionally repressed during iron-replete growth conditions to reduce accumulation of intracellular iron. Evidence

has emerged that small RNA regulators are implicated in bacterial stress responses [22]. These small RNAs act by base-pairing with specific mRNAs whose translation they stimulate or inhibit in the presence of a unique protein, the RNA chaperone Hfq. A small RNA of 90 nucleotides determined to regulate genes involved in iron homeostasis in E. coli [23] and Pseudomonas aeruginosa [24] was termed RyhB. It is negatively regulated by Fur and was shown to down-regulate the translation of many of the same iron-dependent enzymes we detected AZD4547 as decreased in iron-starved Y. pestis cells (SdhA, AcnA, FumA, FrdA, SodB, KatE and KatY) [23]. We

hypothesize that one or both of the conserved Y. pestis homologs of RyhB [22] co-regulate Y. pestis iron homeostasis and selectively decrease translation of mRNAs whose protein products depend on or store iron, as illustrated in Figure 5. Such a mechanism may restrict the use of scarce intracellular iron to processes pivotal to bacterial survival. Some of the encoding genes (e.g. ftnA, katE and sodB) may also be positively controlled by Fur as Selleckchem Nutlin 3 suggested by Yang et al. [35]. Gel shift assays revealed binding of recombinant Fur to promoter regions upstream of the genes ftnA and katE [20]. Several of the enzymes decreased in abundance in iron-deficient Y. pestis harbor Fe-S clusters. Expression of the respective genes did not appear to be altered under conditions sequestering or depleting iron in Y. pestis according to two DNA microarray studies [33, 35] and suggests post-transcriptional mechanisms. The involvement of RyhB in controlling the abundances of proteins with iron cofactors when cells are iron-deficient needs to be verified. Since our data were derived from proteomic comparisons Suplatast tosilate of Y. pestis cells harvested at different cell densities

(OD600s of ~2.0 for stationary phase cells vs. OD600s of ~0.8 for growth arrested, iron-starved cells), the argument can be made that population density differences account for some of the protein abundance changes. Unpublished data (Pieper, R.) and a previous study analyzing the Y. pestis periplasmic proteome in the context of two growth phases [39] allow us to largely refute this notion. Among the proteins with iron or Fe-S cofactors, only PflB and KatE were increased in stationary vs. exponential phase proteomic profiles with ratios comparable to those observed in iron-rich vs. iron-starved cells. FtnA and Bfr are iron storage proteins and, via regulation by RyhB, were reported to be quantitatively decreased when iron supplies are limited in E. coli [23]. Our data on the FtnA and Bfr orthologs of Y.

Paraffin sections (5 μm) were dewaxed and rehydrated. For light microscopy, peroxidase was quenched with methanol and 3% H2O2 for 15 minutes. Antigen retrieval was done in 0.1 mol/L citrate buffer (pH = 6) in an 800W microwave for 15 minutes (the step was omitted in fresh frozen

section staining). After washing in PBS, the following primary antibodies were used: rabbit polyclonal anti-human LYVE-1 (10 μg/ml, Angiobio Co, USA), rabbit monoclonal anti-human podoplanin (1:100, Angiobio Co, USA), mouse monoclonal anti-human CD31 (ready to use, Zhongshan, Beijing), rabbit polyclonal anti-human VEGFR-3, VEGF-C (ready to use, Zhongshan, Beijing). All primary and secondary IgGs were diluted in PBS. Isotypic controls were performed for monoclonal as well as use of non immune serum for polyclonal antibodies (same 5-Fluoracil solubility dmso concentrations as the test antibodies). Determination of LVD (assessed by immunostaining for podoplanin, LYVE-1, VEGFR-3) and CD31 microvessel density (MVD) was performed as suggested by Weidner [18]. Briefly, the immunostained sections were first scanned at a low magnification (40×), and the areas with the greatest number of microvessels (vessel “”hot spots”") were selected for further evaluation. The microvessel count was then

determined by counting all immunostained vessels in five separate hot spots at a high magnification (×200). The average number Opaganib supplier of LVD or MVD in the five selected vessel hot spots was then calculated. In immunostainings for CD31, podoplanin, LYVE-1 and VEGFR-3, any positive cell clusters were considered as endothelial cells and countable microvessels. LVI was considered evident if at least one tumor cell cluster was clearly visible inside the podoplanin-stained vascular space [19]. Peritumoral lymphatic vessels were defined as LYVE-1/podoplanin/VEGFR-3-positive vessels

within an area of 100 μm from the tumor border. Intratumoral lymphatic vessels were defined as LYVE-1/podoplanin/VEGFR-3-positive vessels located within the tumor mass and not confined by invagination of normal tissue [20]. Double immunostaining with podoplanin and Ki-67 Immunohistochemical double stains for Podoplanin and Ki67 were done on serial sections according to Van den Eynden’s method [21]. Podoplanin and Ki-67 DCLK1 was stained by D2–40 and anti-Ki67 monoclonal antibody, respectively. (Angiobio & Beijing Zhongshan Jinqiao Biotechnology Co., respectively) Histastain™-DS double immunostaining kit was purchased from Zymed. In brief, sections were first incubated with primary antibody, i.e. podoplanin (dilution 1:200), and biotinized secondary antibody, which was visualized with the Envision + dual link system (Dakocytomation, Carpinteria, CA, USA). A second primary antibody, i.e. Ki67 (dilution 1:100) was then applied and visualized with the Envision G/2 system/AP (Dakocytomation, Carpinteria, CA, USA).

Differences between groups were analyzed by one-way analysis of variance with a Bonferroni posttest using Prism software

(version 5.01; GraphPad). P< 0.05 was defined as statistically significant. Results OM proteome analysis following cold shock in M. catarrhalis To assess cold shock-induced changes in the OM proteome of M. catarrhalis, 2-DE analysis was used. OMPs were isolated from a culture of M. catarrhalis strain O35E, which was exposed to a 3-hour cold shock at 26°C or to continuous growth at 37°C. A collection of 6 gels (3 of each temperature) resulting from three independent experiments was analyzed. Three OMPs (~75 kDa, pI9; 50 kDa, pI7; and 14 kDa, pI8) were found to be differentially (a greater than twofold change) regulated in response to a 26°C cold shock (Figure 1). Among these proteins, BTK inhibitor two spots (75 and 15 kDa) were upregulated and one spot (50 kDa) was down-regulated see more at 26°C (Figure 1A) in comparison with exposure to 37°C (Figure 1B). The 75 kDa spot, which is upregulated at 26°C, was identified by comparing spot pattern of M. catarrhalis O35E wild-type and O35E.tbpB mutant strain as TbpB (Figure 1C), a peripheral OM lipoprotein possessing transferrin-binding properties, indicating that cold shock may increase iron acquisition, which

is important for both growth and virulence. Increased expression of genes involved in iron acquisition of M. catarrhalis induced by cold shock To confirm the contribution of TbpB in the cold shock response, we assessed the tbpB mRNA expression level of strain O35E exposed to either 26°C or 37°C. The expression level of tbpB was significantly increased at 26°C in comparison to expression at 37°C (Figure 2A). A similar expression pattern of tbpB was also observed in M. catarrhalis clinical isolate 300 (data Sinomenine not shown). Cold shock at 26°C also enhanced the mRNA level of tbpA, an integral OM transferrin binding protein (Figure 2B). Low free iron conditions (30 μM of desferioxamine

in the medium) caused an increase in gene transcription in bacteria grown at 37°C to a level similar to that seen in cells exposed to cold shock. Figure 2 Increased expression of genes involved in iron acquisition of M. catarrhalis due to cold shock. A, increased mRNA levels of M. catarrhalis tbpB following to cold shock. Strain O35E, grown to midlogarithmic phase, was exposed for 1 h and 3 h to 26°C or 37°C. RNA was analyzed by quantitative real-time reverse-transcription PCR to determine the amount of tbpB and 16S rRNA transcripts. The graph shows one of three representative experiments done in triplicate. Data are presented as means ± 1 standard deviation. *, P< 0.05 for 26°C versus 37°C (one-way analysis of variance). B, C and D, increased mRNA levels of M. catarrhalis tbpB, tbpA, lbpB and lbpA due to cold shock. M.

Ecder T, et al. Am J Kidney Alvelestat cost Dis. 2000;35:427–32. (Level 2)   8. Schrier R, et al. J Am Soc Nephrol. 2002;13:1733–9. (Level 2)   9. Kanno

Y, et al. QJM. 1996;89:65–70. (Level 4)   10. Nutahara K, et al. Nephron Clin Pract. 2005;99:c18–23. (Level 2)   11. Mitobe M, et al. Clin Exp Nephrol. 2010;14:573–7. (Level 4)   12. Zeltner R, et al. Nephrol Dial Transplant. 2008;23:573–9. (Level 2)   13. Ecder T, et al. Am J Nephrol. 2001;21:98–103. (Level 3)   Does screening of intracranial aneurysms improve the prognosis in patients with ADPKD? The high incidence of intracranial aneurysms in patients with ADPKD has long been recognized. Rupture of an intracranial aneurysm resulting in subarachnoid hemorrhage (SAH) is the most devastating of extrarenal complications, and often results in premature death or disability. The overall prevalence was estimated to be 3.2 % (95 % CI 1.9–5.2) in a population without comorbidity, with a mean age of 50 years, and a 50 % component of men. Compared with populations without comorbidity, the prevalence ratio was 6.9 (95 % CI 3.5–14) for PF-02341066 purchase ADPKD. First-degree relatives (parents, siblings, and children) of patients with subarachnoid hemorrhage have a three to seven times higher risk of SAH than the general population. Size of the aneurysm

size correlates with the presence of symptoms and the risk of bleeding, and aneurysms may rupture more often and at a younger age as compared with sporadic aneurysms. Large aneurysms seem to occur more often in patients with ADPKD than in those without. Intracranial hemorrhage, either cerebral hemorrhage or aneurysmal SAH, can cause high mortality and morbidity in PKD patients. Screening of intracranial aneurysms improves the prognosis. If the result of screening by MR angiography is negative, rescreening of patients with a good life expectancy at 5-year intervals seems reasonable. Bibliography 1. Chauveau D, et al. Kidney Int. 1994;45:1140–6. (Level 4)   2. Schievink WI, et al. J Am Soc Nephrol. 1992;3:88–95. (Level 4)   3. Vlak MH, et al. Lancet Neurol. 2011;10:626–36. (Level 4)   4. Irazabal MV, et al. Osimertinib mw Clin J Am Soc Nephrol. 2011;6:1274–85.

(Level 4)   5. Xu HW, et al. Stroke. 2011;42:204–6. (Level 4)   6. Gieteling EW, et al. J Neurol. 2006;250:418–23. (Level 4)   7. Wiebers DO, et al. Lancet. 2003;362:103–10. (Level 4)   Are newer quinolones recommended for the treatment of cyst infection in ADPKD? Cyst infection is a frequent and serious complication of ADPKD and is often refractory and difficult to treat. Most causative bacteria originate from the intestine and many are gram-negative rods. Fluoroquinolones, which have broad effectiveness against gram-negative rods and good penetration into cysts, is recommended for the treatment of infected cysts in ADPKD. Having said this, however, there has not been an adequate level of study to investigate the actual effectiveness of fluoroquinolones for treating cyst infection in ADPKD.

Values marked with an asterisk (*) differed significantly from the M1 reference value of zero liters (P < 0.05). Short dashed lines represent one-side SE bars. Prior to the evaluation of osmolality and pH for the urine samples, both Control and Experimental groups were split into ""low"" and ""high"" subgroups using each group's respective median values for daily PA, SRWC, and average PRAL. These subgroups were used as a basis for reevaluating the urine measures since each of these variables can independently influence urine osmolality and pH. Summary statistics for PA, SRWC, and average

PRAL for the resulting Quizartinib ic50 subgroups are provided in Table 5. A complete summary of urine osmolality results are provided in Tables 6 and 7 for Control and Experimental groups, respectively. There were no significant changes in urine osmolality for the Control group over the entire Testing Phase, regardless of whether the entire group or subgroups were evaluated. Urine osmolality for urine samples collected in the second week of the treatment

period for the Experimental group, however, were significantly higher than the pre-treatment reference value. The subgroup analyses also indicated that urine osmolality tended to be significantly higher at the end of the treatment period for Experimental subjects within the “”high”" daily PA, “”low”" SRWC, and “”high”" PRAL subgroups. Tables 8 and 9 show that the trends for changes in urine pH paralleled

those discussed for urine osmolality. Specifically, Etomidate there were check details no significant changes in urine pH across all measurements for the Control group which includes the daily PA, SRWC, and PRAL subgroup analyses (Table 8). In contrast, when considering the Experimental group urine measures (Table 9), pH increased progressively and significantly throughout the treatment period by approximately 0.3 to 0.8 units. This same trend was evident throughout the “”low”" and “”high”" Experimental subgroup analyses as well with the largest pH increases (+0.5 to +1.2 units) observed for the “”high”" daily PA, “”high”" SRWC, and “”high”" PRAL subgroups. Interestingly, observed changes in daily urine output, osmolality, and pH for the Experimental group all returned to pre-treatment levels during the post-treatment period. Table 5 Summary statistics of sub-group analysis variables reported as Mean ± SD (Range). Grouping Variables Control Group (n = 19) Experimental Group (n = 19)   “”Low”" (n = 9) “”High”" (n = 10) “”Low”" (n = 9) “”High”" (n = 10) †Daily PA (mins/day) 41.2 ± 14.7 (15.0 – 63.0) 96.6 ± 19.9 (68.0 – 127.0) 51.3 ± SD (16.0 – 73.0) 102.7 ± 32.6 (75.0 – 173.0) ‡SRWC (L/day) 1.4 ± 0.3 (1.0 – 1.9) 3.1 ± 1.1 (2.0 – 5.6) 1.4 ± 0.23 (1.0 – 1.7) 2.95 ± 0.84 (1.8 – 4.7) §PRAL (mg/day) 5.72 ± 9.40 (-8.30 – 23.9) 45.30 ± 25.85 (24.60 – 114.90) 3.28 ± 11.8 (-22.2 – 15.0) 35.05 ± 17.3 (18.4 – 74.

The membrane was then washed with 1 × PBS containing 0.05% Tween-20, and incubated with a secondary anti-rabbit antibody labeled with the fluorescent IRDye™ 800 (Rockland). Fluorescence was detected using an Odyssey Infrared Imaging System (LI-COR). Identification of the integration site and orientation of SfX and SfI Based on previous studies showing that the integration site of serotyping-conversion bacteriophages is conserved [15], a series of primers were designed that were located in genes proA, yaiC, gtrI, gtrX, intI and intX across the presumptive integration region to determine the site and selleck products order of integration using PCR: proA-F, ACAAAGCGAAATCATCCTCAA;

intI-R, AGTGTTACAGGAAATGGGAGGC. gtrI-F, ATTGAACGCCTCCTTGCTATGC; intX-R, TACGGTGGCTGCGTGAGAA. gtrX-F, TACCTTGACCCGTTTCCG; and yaiC-R, GCAGGAAACCACCATCAACACC. PCR products were sequenced commercially to identify the www.selleckchem.com/products/AZD6244.html integration site precisely. Acknowledgements This work was supported by grants (2011CB504901, 2008ZX10004-008, 2008ZX10004-009, 2008ZX10004-001, 2009ZX10004-203, 2011SKLID203, 2008SKLID106, and YB20098450101) from the Ministry of Science and Technology, and State

Key Laboratory for Infectious Disease Prevention and Control, People’s Republic of China. We thank the referees for helpful suggestions. Electronic supplementary material Additional file 1: Supplementary figure. DNA sequences of integration sites in 036, 036_X and 036_1d, and bacteriophages SfI and SfX. Sequences obtained by PCR and sequencing of junction regions using a series of primers across the integration site as described in the text. (A) attB in strain 036. (B) attP in phage SfI. (C) attP in phage SfX. (D) attL in strain 036_X. (E) attR in 036_X and 036_1d. (F) Sequence between phage SfI and SfX in strain 036_1d. Sequences in box are conserved DNA regions between

genes; Underlined sequences are tRNA-thrW; Sequences in blue are att core sequence; Conserved genes flanking a given integration site are shaded and their transcription this website orientation is marked by an arrow. (PDF 427 KB) References 1. Kotloff KL, Winickoff JP, Ivanoff B, Clemens JD, Swerdlow DL, Sansonetti PJ, Adak GK, Levine MM: Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull World Health Organ 1999,77(8):651–666.PubMed 2. Bardhan P, Faruque AS, Naheed A, Sack DA: Decrease in shigellosis-related deaths without Shigella spp. -specific interventions, Asia. Emerg Infect Dis 2010,16(11):1718–1723.PubMed 3. Bennish ML, Wojtyniak BJ: Mortality due to shigellosis: community and hospital data. Rev Infect Dis 1991, 13:S245–251.PubMedCrossRef 4. Clemens JD, Kotloff KL, Kay B: Generic protocol to estimate the burden o Shigell diarrhoea and dysenteric mortalit. Geneva: World Health Organization; 1999. 5. Ye C, Lan R, Xia S, Zhang J, Sun Q, Zhang S, Jing H, Wang L, Li Z, Zhou Z, et al.

Figure 5 The XPS spectra of the Al 2 p states of the CNTs. (a) The XPS result of the CNT-C emitter. (b) The XPS result of the CNT-D emitter. Figure selleckchem 6 The FESEM images before and after the stability test. The morphologies of the CNT-B emitter, which were measured at the (a) initial (i.e., before the stability test) and (b) final (i.e., after 20-h emission)

stages of electron emission. The CNT-D emitter’s morphologies measured at the (c) initial and (d) final stages of electron emission. Conclusions The conical-type CNT-based field emitters were fabricated using the EPD method. Substantially, enhanced emission characteristics, such as lower turn-on voltage and higher emission currents, were obtained by thermally treating the CNTs. From the FESEM observations as well as from the electrical measurements of emission characteristics, the thermal treatment barely affected the CNTs’ surface morphologies and field enhancement factors. The observations of the Raman spectra confirmed that the improved emission Kinase Inhibitor Library research buy characteristics of the thermally treated CNTs were ascribed to their higher degrees of crystallinities.

In addition, the long-term emission stabilities of the CNTs were significantly ameliorated by coating Al interlayers prior to the deposition of CNTs. The CNTs, when deposited on the Al interlayers and thermally treated, exhibited highly stable electron emission behaviors without any significant degradation

of emission currents even after 20 h of operation. The XPS results indicated that the improved adhesion of CNT-D was ascribed to the increase of Al-O bonds and the creation of Al-C bonds by thermal treatment. This may diminish the possibility of electric arcing at the W tip and also enhance the W tip’s robustness against melting, which may eventually lead to the improved long-term emission stability of the CNTs. It was also reported by our previous work [14] that the emission stabilities of CNTs deposited on the W tips coated with Hf interlayer were improved only when the CNTs were thermally treated. This was due to the formation of carbide bonds (Hf-C) either at elevated temperature. In this study, the CNTs using Al interlayers showed that the enhanced emission stabilities were observed not only for the thermally annealed CNTs but also for the as-deposited CNTs without thermal treatment. This was because oxide bonds (Al-O) already existed in the as-deposited CNTs, while carbide bonds (Al-C) were observed for the thermally annealed CNTs. Authors’ information BJK is currently a Ph.D. student of Electronic Systems Engineering Department in Hanyang University. His research focuses on the application of carbon nanotube in X-ray system and transparent conductive films. JPK, Ph.D., is currently working in Health & Medical Equipment Business Team, Samsung Electronics. JSP, Ph.D.

Phys Rev B 1972, 6:4370–4379.CrossRef 23. Marinica DC, Kazansky AK, Nordlander P, Aizpurua J, Borisov AG: Quantum plasmonic: nonlinear effects in the field enhancement of a plasmonic nanoparticle dimer. Nano Lett 2012, 12:1333–1339.CrossRef 24. De Abajo FJ G: Nonlocal effects in the plasmons of strongly interacting nanoparticles, dimers, and waveguides. J Phys Chem C 2008, 112:17983–17987.CrossRef 25. Oulton RF, Bartal G, Pile DFP, Zhang X: Confinement and propagation characteristics of subwavelength plasmonic modes. New J Phys 2008, 10:1367–2630.CrossRef Competing interests The authors declare that they have no competing

interests. Authors’ contributions WW proposed the asymmetric idea, calculated properties of the proposed waveguide, and wrote the manuscript. XZ, YH, and XR analyzed the data and revised the manuscript. All authors read and Rucaparib molecular weight approved the final manuscript.”
“Background Cu2ZnSn(S,Se)4 (CZTSSe) quaternary semiconductors attract a lot of interest for thin-film solar cells [1]. Competition in the solar cell market is nowadays hard-hitting,

so it is getting more concern on the cost in the manufacturing of the thin-film solar cells. CZTSSe consists Trametinib concentration of relatively cheap and earth-abundant elements of Zn and Sn. In contrast, Cu(In,Ga)Se2 (CIGS), which is now mostly promising for commercialization, has expensive and rare elements of In and Ga. CZTSSe shows high absorption coefficient and the band gap of it can be tuned with changing S and Se composition. So far, the highest conversion efficiency

of CZTSSe is reported as 11.1% in non-vacuum process with hydrazine [2] and 9.2% in vacuum process by co-evaporation [3, 4]. Very recently, Solar Frontier announced the conversion efficiency of 10.8% in the CZTSSe solar cell module GBA3 of 14 cm2[5], which indicates presumably 12 to 13% of the conversion efficiency in the cell level. For large area deposition, sputtering methods have an advantage in production of CZTS-based solar cells [6, 7]. It is likely that compound sources such as ZnS and SnS can improve adhesion between the substrate and the thin film during deposition. Moreover, it is believed that the method can increase grain size, control composition, and improve surface morphology of precursors [8, 9]. In order to put Se into the as-grown CZTS stacked precursors, optimization of annealing conditions of the precursors in Se atmosphere is decisively important. In previous reports, the different stacking orders of precursors determine the crystallinity and grain growth of the CZTSSe thin films [10, 11]. The results showed dense morphology and little voids on surface in case of Cu/SnS/ZnS/Mo/glass [12, 13]. There are some models to exhibit the advantageous properties of grain boundaries (GBs) of polycrystalline CIGS. Jiang et al. proposed that GBs acting as a factor to improve cell performance contrary to single-crystal solar cells by scanning probe characterization.