2308, P ≤ 0.0001). Table 3 Stepwise regression analysis for soluble α-Klotho levels in the total study population Variables α-Klotho β F P eGFR 0.604 70.725 <0.0001 Log FGF23 0.166 5.93 <0.05 Hb −0.102 2.649 0.1 Total R 2 = 0.2308, P < 0.0001 Stepwise multiple

regression analysis was performed in all subjects (n = 292) The dependent variable is soluble α-Klotho levels F values for the inclusion and exclusion of variables were set at 4.0 at each step Discussion The findings of this study demonstrate that serum soluble α-Klotho level is positively associated with eGFR and inversely associated with age and serum FGF23 level. Serum soluble α-Klotho levels were significantly decreased in stage 2 CKD compared with stage 1, and not only in the advanced stages Foretinib order of the disease. Our data thus demonstrate that serum soluble α-Klotho may represent a useful biomarker for detecting early stage CKD. To our knowledge, check details this is the first report showing that serum soluble α-Klotho level is decreased in stage 2 CKD compared with stage 1. Early diagnosis of CKD is critical to prevent CKD progression and associated complications, including cardiovascular events. Most CKD biomarkers currently in clinical use are not sensitive enough and cannot accurately detect early stage disease [4–6]. In addition to being decreased in stage 2 versus

stage 1 disease, we found that serum soluble α-Klotho level was associated positively with eGFR and inversely with serum creatinine level.

Particularly in the early stages of CKD (stage 1–3), serum soluble α-Klotho level showed a highly positive association with eGFR. Our data thus indicate that serum α-Klotho may represent a new sensitive biomarker for CKD, especially in the early stages of the disease. The following mechanisms may underlie the early decrease in α-Klotho levels we observed. Secreted α-Klotho results from the shedding of membrane α-Klotho, which is expressed in renal distal tubules. A decrease in soluble α-Klotho therefore reflects a decrease in the amount of membrane α-Klotho. A subtle decrease in nephron number may already occur in the early stages of CKD. Membrane α-Klotho is a co-factor for FGF23, and a decrease in membrane α-Klotho may prevent the actions of FGF23 in CKD. A recent study revealed that activation of the renin–angiotensinogen–aldosterone second system (RAAS) reduces renal expression of α-Klotho [25]. Further, activation of the RAAS has been reported to occur in CKD [25]. Thus, activation of the RAAS may be responsible for the reduction in secreted α-Klotho levels in the early stages of CKD observed in our study. Previous studies have reported that expression of α-Klotho is reduced in the kidney in Ro 61-8048 supplier animal CKD models and patients with CKD [26–28] and that a decrease in urinary α-Klotho levels is evident in the early stages of CKD in a relatively small number of patients [29]. Our data are in accordance with these previous studies.

m. learn more morsitans female and male adult flies from the Yale University laboratory colony. Dissections were performed in 1X PBST ((3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl, 0.05% Tween 20, pH 7.4), and dissected tissues were placed in 200

μl of lysis buffer (Qiagen, Valencia, CA). The DNA was isolated using a Qiagen DNeasy kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. PCR amplication of 16S rRNA, fbpA, and wsp were performed using the primers wspecF/wspecR, fbpA_F1 / fbpA_R1 and 81F / 691R, respectively [2, 41, 57] (see Additional file 1- Supplementary Table 1). PCR mixes of 25 μl contained 5 μl of 5x reaction buffer (Promega, Madison, WI), 3 μl MgCl2 (25mM), 0.5 μl deoxynucleotide triphosphate mixture (25 mM each), 0.5 μl of each primer (10 μM), 0.125 μl of Taq (Promega, LY3023414 in vitro Valencia, CA) (1U/μl), 14.375 μl water and 1 μl of template DNA. The PCR protocol was: 35 cycles of 30 sec at 95°C, 30 sec at 54°C and 1 min at 72 °C. Phylogenetic analysis All Wolbachia gene sequences generated in this study were

manually edited with SeqManII by DNAStar and aligned using MUSCLE [58] and ClustalW [59], as implemented in Geneious 5.3.4 [60], and adjusted by eye. Phylogenetic analyses were performed using Bayesian Inference (BI) and Maximum-Likelihood (ML) estimation for a concatenated data set of the protein-coding genes (gatB, fbpA, hcpA, ftsZ and coxA) and for wsp separately. For the Bayesian inference of phylogeny, PAUP version 4.0b10 [61] was used to select the optimal evolution model by critically evaluating the selected parameters using the Akaike Information Criterion [62]. For the concatenated data and the wsp set, the submodel GTR+I+G was

selected. Bayesian analyses were performed as implemented in MrBayes 3.1 [63]. Analyses were initiated from random starting trees. Four separate runs, each composed of four chains, were run for 6,000,000 generations. The cold chain was sampled every 100 generations, and the first 20,000 generations were discarded. Posterior probabilities were computed for the remaining trees. ML trees were constructed using MEGA 5.0 [64], with gamma distributed rates with 1000 bootstrap replications, and the method of Jukes and Cantor [65] as genetic distance model. Nucleotide sequence accession numbers. All MLST, wsp and 16S rRNA gene sequences generated in this MG-132 nmr study have been deposited into GenBank under accession numbers JF494842 to JF494922 and JF906102 to JF906107. Results Wolbachia infection prevalence in different populations The presence of Wolbachia was investigated in nine species within the three subgenera of Glossina. A total of 551 laboratory and 3199 field-collected adult flies, originating from 10 African countries, were tested using a Wolbachia specific 16S rRNA-based PCR assay (Table 1). The prevalence of Wolbachia infections differed significantly between the various populations of OSI-027 price Glossina (Table 1).

PCR products were resolved by gel electrophoresis, stained with ethidium bromide

and visualised and captured under UV-light. All nine biofilm forming isolates and nine isolates closely selleck related to these based on RFLP results [12], ten isolates harbouring ISMpa1 [12, 41] and 13 other isolates were screened for the presence of the six GPL biosynthesis genes. All together 42 isolates were examined (27 isolates from swine, ten from humans and five from birds including the reference strains ATCC 25291, R13 and M. avium 104). Table 1 Primers and GenBank coding positions for the glycopeptidolipid (GPL) genes examined in this study Gene AF125999 Veliparib coding position Primer sequence Start-stop within gene (prod size in bp) merA 15360–16379 P102 tattgactggccctttggag 452–659 (208)     P103 gctttggcttcctcatatcg   mtfF 16655–17377 P104 gctgccgatgcttaaaagtc 342–499 (158)     P105 gcttctcgaaaccctgtacg   mdhtA 14389–15420 P106 gacccggatgaggtctacaa

232–402 (171)     P107 gaacatctccgacgaggaag   rtfA 4488–5774 P108 ccattggtcgtgaactgatg 56–214 (159)     P109 ttttgaagaagtcccggatg   gtfA 2807–4084 P112 ttctggaagatgggggagat 223–400 (178)     P113 gcggaaggtcgtaatactcg   mtfC 5876–6676 P114 ggcgtgatctgaccaggtat 44–266 (223)     P115 tcttccagaaccgtttccac   Results Method optimisation Biofilm formation by the 17 isolates of M. avium with respect to incubation time, temperature and media is described in Figure 2. Only four check details isolates formed biofilm, and the greatest amount of biofilm was obtained using 7H9 with

OADC and Tween. A mixture of 50% sterile distilled water and 50% 7H9 with OADC and Tween or 7H9 without OADC and Tween both gave less biofilm formation. None of the isolates showed growth or formed biofilm when incubated in Hanks’ balanced salt solution or water from different sources, including distilled water, sterile filtrated or autoclaved potable water and lake water (results not shown). All temperatures and incubation times tested gave good biofilm formation by the biofilm positive isolates using 7H9 with OADC and Tween as medium. The best results were obtained at 28°C and by using three weeks of incubation. The trait of biofilm Bay 11-7085 production was consistent between the isolates, and the non-biofilm forming isolates were negative under all conditions (Figure 2). Figure 2 Biofilm formation for the different conditions tested. Fourteen Mycobacterium avium subspecies hominissuis (seven from humans, six from swine, one from a bird), and three M. avium subsp.avium isolates from birds were used to optimise the method. Results are represented as mean OD595 value after crystal violet staining of biofilm + SEM (Standard error of the mean).

One interviewee suggested the development of an in-built evaluation of the research process, its outputs, and the way in which results were communicated incorporated into the research design. The evaluation could include feedback from potential users of the research. In

addition, the evaluation could include lessons from other experiences and practices. This was perceived to have the potential to provide useful ‘good practice’ lessons for future policy- or society-relevant research processes. Finally, consideration should be given to the merits of cross-reviewing: for example in addition to academics reviewing academic papers (peer-review) and policy-makers reviewing policies, the merits of academics and other stakeholders reviewing policy, or policy-makers and other selleck products stakeholders reviewing academic outputs should be explored. Within academia, for example, the reviewing process (for quality assurance

of science) is done by an author’s peers in the scientific community. Whilst this should not be ignored, there may be some benefits of having scientific work reviewed by peers Selleckchem P505-15 within other communities (e.g. other scientific disciplines or Schools, policy, NGOs, etc.) (Funtowicz and Ravetz 1993). These actors could evaluate the scientific outputs critically to make these more policy-relevant if possible. This type of reviewing would also 4-Aminobutyrate aminotransferase address some of the interviewees’ comments on the potential lack of feedback from GS-1101 cost funders on contracted research reports at the end of projects. However we note that as cross-reviewing is time consuming for all involved, planning and funding cross-reviewing initiatives would need to be recognised and resourced accordingly. Finally, the whole process of framing the questions and research process jointly is likely to lead to a better understanding of the types of outputs useful for policy, namely outputs that are

presented in the right format, using understandable language, in a timely way and addressing the institutional level (e.g. global, European, national, regional, organizational, team, individual) relevant for the given knowledge users. The framing of science and policy can also be instrumental in strategic and long-term planning. Lack of coordinated planning between science and policy can lead to ‘closed’ thinking and a focus on immediate priorities for policy, without regard to identifying and acting on emerging and/or long-term issues. The lack of a strategic, long-term overview from policy and, in turn, science, may risk wasting resources and also risks duplicating previous work commissioned or carried out, particularly for small or applied projects. Moreover, institutional organisation of science may induce researchers to focus on improving knowledge on already well-studied topics rather than exploring new themes (Grandjean 2013).

Cells were lysed by sonication on ice water (2 × 20 sec, Branson sonifier 250, 3 mm disruptor horn, output level 2, constant), and the lysate cleared by centrifugation

at 14000 rpm, 18°C for 20 min in a tabletop centrifuge. A cellulose column was prepared by pipetting 30 mg Avicell PH-101 (Fluka) resuspended in 300 μlCFE into a Mobicol empty spin column (MoBiTec). The column was centrifuged (300 × g, 1 min, RT), washed with 600 μlCFE to remove fines and centrifuged again. The cleared lysate was buy C646 applied to the column in 600 μlportions and the cellulose resuspended by pipetting up and down. After 1 min incubation at room temperature, the column was centrifuged (300 × g, 1 min, RT) and the flow-through discarded. The cellulose was washed three times with 600 μlCFE + 0.5% NP40 (Roche) and once with CFE. After each washing step the column was

centrifuged (300 × g, 1 min, RT) and the flow-through discarded. An additional centrifugation (770 × g, 1 min, RT) was performed after the last washing step to reduce the amount of retained buffer. For elution, 600 μl ethylene glycol (Merck, Darmstadt) were applied to the column, the cellulose resuspended, and the column centrifuged. Eluted proteins were precipitated with TCA. For this, an equal volume of 20% (w/v) TCA was added to the eluate, the mixture incubated on ice for 30 min and centrifuged at 14000 rpm, 4°C, 30 min. Finally, the pellet was washed 2-3 times with ice-cold 50% (w/v) acetone. For SILAC-based one-step bait-fishing AZD4547 experiments the above protocol was modified as follows: The bait expression strain and the bait-control strain were precultured in 35 ml complex medium containing 0.15 μgm l −1 novobiocin at 37°C on a Caspase-independent apoptosis shaker (150 rpm) until an O D 600of 0.5-1.0 was reached. Five hundred microliters of these

cultures were used to inoculate second precultures that were grown under identical conditions to an O D 600of 0.8-1.0. The second precultures were used to inoculate 100 ml synthetic medium this website containing 13C6-leucine for the bait expression strain and 12C6-leucine for the bait-control strain at an O D 600 of 0.01; the inoculum was adjusted to 1.5 ml with complex medium before addition to the 100 ml medium. The main cultures were incubated on a shaker (110 rpm) at 37°C in the dark until they reached an O D 600 of 0.8. Cells were harvested by centrifugation (8000 rpm, 15°C, 15 min) and pellets resuspended in 1 ml CFE + PI. Cell lysate and cellulose columns were prepared as described above. Three hundred microliters lysate from each culture were applied to the column, the cellulose resuspended, and after 1 min incubation the column centrifuged (300 × g, 1 min, RT). This step was repeated twice, followed by washing, elution, and protein precipitation as described. Two-Step bait-fishing experiments were performed with the following modifications: Hbt.salinarum R1 was precultured twice in 35 ml complex medium at 37°C on a shaker (110 rpm) until an O D 600 of 0.5-1.0 was reached.

Methods Bacterial BI 6727 growth conditions and MIC assays Bacterial strains used in this work are listed in Additional file 1: Table S2. Overnight cultures of bacteria were inoculated at an OD600 of 0.025 in LB broth supplemented with antibiotic in the absence and presence of DSF or its structural analogue (Table 1). One

hundred microliters of inoculated culture were grown in each well at 28°C or 37°C as indicated with shaking at 200 rpm for 24 hours (Additional file 1: Table S2). MIC was defined as the lowest concentration of antibiotic in which bacterial growth in the well was not measureable by determination of the turbidity at 600 nm, and determined following the method from the Clinical and Laboratory Standards Institute (CLSI) [38]. Bacterial growth analysis Overnight bacterial cultures grown in LB broth were inoculated in the same medium to an OD600 of 0.025 in the absence and presence of DSF or its analogue at a final concentration of 50 μM. Three hundred microliters of inoculated culture were grown in each well at 28°C or 37°C as indicated in Additional file 1: Table S2 in a low intensity shaking model using the Bioscreen-C Automated Growth Curves Analysis System (OY Growth Curves AB Ltd., Finland). Biofilm formation assays Biofilm formation was assayed

using 96-well polypropylene microtitre dishes. Overnight bacterial cultures grown in LB broth were inoculated in the same medium to an OD600 of 0.01 in the absence and presence of DSF signal at different concentrations as indicated. One hundred microliters of inoculated culture were grown in each well at 37°C JAK inhibitor with shaking at 150 rpm for 18 h. The cultures were removed and 200 μl of 1% crystal violet (w/v) was added. Following staining at room temperature for 15 min, the dye was removed and the wells

were rinsed three times with water. For NVP-BGJ398 manufacturer quantification of the attached bacterial cells, the stained wells were decolorized with 200 μl of 95% ethanol. The quantity of crystal violet was determined by measuring the absorbance at 595 nm. Persistence Thymidylate synthase assays Persistence was measured by determining the number of cfu/mL after exposure to 10 μg/mL gentamicin. Overnight cultures were diluted 100-fold in 10 mL of fresh medium and incubated at 37°C at 250 rpm to an OD600 of 1.0. Cultures were incubated with shaking at 150 rpm at 37°C supplemented with gentamicin in the absence and presence of DSF signal at a final concentration of 50 μM. For determination of cfu, 1-mL aliquots were removed at the indicated time points and cells were serially diluted in fresh medium and plated on solid medium. Persisters were calculated after incubation at 37°C overnight. Cytotoxicity assays in HeLa cell model The synergistic effect of DSF signal with antibiotic on the virulence of B. cereus was assayed by using HeLa cells.

This efficacy was found to be independent of baseline risk factors [11] and to be maintained over 5 years against placebo

[12] with a good safety profile. Results of a pooled extension study of the SOTI and TROPOS populations to 8 years [13] suggested the maintenance of the antifracture efficacy over 8 years of continuous treatment with strontium ranelate. In this Barasertib article, we describe the results of a pooled longer-term open-label extension of the SOTI and TROPOS studies to evaluate the efficacy and safety of strontium ranelate up selleck screening library to 10 years. Methods Study design and patients The procedures for the open-label extension study of SOTI and TROPOS have been described extensively elsewhere

[13]. The initial 3-year extension (8 years’ continuous treatment) was increased by 2 years to reach a total of 10 years’ continuous follow-up. The 10-year extension study therefore enrolled postmenopausal women with osteoporosis who had completed 5 years of treatment with strontium ranelate or placebo in the SOTI and TROPOS studies (years 0 to 5) plus a further 5 years of treatment in the extension phase (years 6 to 10) [9, 10] (Fig. 1). The main reasons for not continuing were either patient’s own personal decision or investigator’s decision according to the patient’s status (e.g. age or mobility). During the open-label extension, all patients received strontium ranelate PIK3C2G HDAC inhibitors cancer 2 g/day, as well as calcium (< 1000 mg/day) and vitamin D (400 to 800 IU/day). All patients gave written informed consent before inclusion in both parts of the extension study (at year 6 and year 9), which was approved by institutional

ethics review committees. In this article, results will be restricted to the 10-year population (n = 237), i.e. patients from the active treatment arms of SOTI and TROPOS who received strontium ranelate for up to 10 years. Fig. 1 Flow of patients Efficacy endpoints The main efficacy endpoints were the incidence of new osteoporotic fractures and the change in lumbar spine, femoral neck, and total hip BMD between years 6 and 10. The procedures used to evaluate the incidence of fractures are described in detail in the original reports [9, 10, 13]. All patients from the SOTI trial had spinal X-rays at inclusion and yearly thereafter. The patients from the TROPOS study in whom spinal X-rays were routinely performed continued to have them in the extension phase. Spinal X-rays were read centrally and incident vertebral fracture detected by semi-quantitative assessment and grading [14].

The nonlinear response arises from the excitation of extra carriers which is reflected as an opposite response in the resistance change compared to the bolometric response. The main aspects of characterization were indicated by the small arrows in the previous response curves of Figure 5; the arrows simply indicate two sets of information. The first aspect is the change in the average resistance value for the transition from the THz-OFF state to the THz-ON state.

The second aspect is the instantaneous value of the resistance at the two moments where THz radiation starts and the moment where THz radiation learn more is terminated. Furthermore, looking into the data analysis, sample 3 (metallic type) and sample 2 (semiconductor type) started in the THz-OFF state for 3 min where the average fluctuation amplitude was estimated to be 0.03 and 0.15 KΩ, respectively. Pulsed THz radiation was applied for 3-min intervals, as indicated by the gray-shaded regions in Figure 2. The devices’ bolometric response to THz radiation is reflected by the correlating

resistance amplitude fluctuations. Examining Figure 6, the differences in fluctuation amplitudes show a clear variation between complete THz-OFF and THz OFF-ON states. Metallic click here characteristics are observed for sample 3 after three successive cycles of exposure with an amplitude increase of 0.05 KΩ. Conversely, sample 2 shows semiconductor characteristics after two successive cycles of exposure with an amplitude decrease of 0.40 KΩ. The GDC 0032 purchase fluctuation amplitudes increase by a factor of 2 relative to the original THz-OFF state. Cycle 4 for sample 3 and cycle 3 for sample 2 show opposite responses since the change due Bumetanide to THz-ON radiation does not fade out with the THz-OFF state. Consequently, the response shows a linear growth for the fluctuation amplitudes. The metallic sample’s average fluctuation amplitude increases by 0.08 KΩ during the THz-ON state, while the semiconductor sample’s average fluctuation amplitude decreases by 0.65 KΩ during the THz-ON state. The fluctuation amplitudes changed by

a factor of 3 relative to the original THz-OFF state. These trends can be observed in comparison to the original fluctuation as shown in Figures 5 and 6. Transitions in response occur in correspondence to the opposite response observed in cycle 4 of sample 3 and cycle 3 of sample 2, as shown in Figure 5. Figure 6 Comparison of the resistance response between THz OFF-ON states and the complete THz-OFF state. The THz-OFF measurement was taken for 10 min and plotted as the blue curve. The same measurement is also fitted on the OFF-ON state measurement to indicate the variation of the fluctuation amplitudes. The background of the plot variation can be viewed as a result of room temperature dependence. Finally, the efficiency of inducing the thermal energy required to observe a bolometric response has been related to the sample’s domain size at the core of the antenna structure.

[1]. Sharper diffraction peaks are observed from the diffraction peaks of the PFO-DBT selleck chemical nanorods which indicate a semi-crystalline polymer. The PFO-DBT nanorod is confined inside the cavity of the template which then alters its molecular selleck screening library structure to a more aligned and elongated chain segment [11, 12]. The crystallite size of the PFO-DBT nanorods can be verified using the Scherrer equation as shown in Equation 1: (1) Figure 6 X-ray diffraction (XRD) patterns of template and PFO-DBT nanorods. The nanorods were grown

inside the template of different spin coating rates. From this equation, L is the mean crystallite size, K is the Scherrer constant with value 0.94, λ = 1.542 Å is the X-ray source wavelength, and β is the FWHM value. The PFO-DBT crystallite size is

around 20 to 30 nm. The PFO-DBT nanorods that have been deposited inside the porous template Selinexor exhibited a semi-crystalline polymer with enhanced polymer chain due to the restricted intrusion into the cavities. Optical properties The absorption spectra of the PFO-DBT nanorod bundles with different spin coating rates are shown in Figure 7a. These spectra portray two absorption peaks mainly assigned to PFO segments (short wavelength) and DBT units (long wavelength). The absorption band of the PFO-DBT thin film has been reported to locate at 388 nm (short wavelength) and 555 nm (long wavelength) [2, 4]. Enhancement on the PFO-DBT’s optical properties can be realized with the low spin coating rate of 100 rpm. With the denser distribution of the PFO-DBT nanorod bundles, the absorption band at short wavelength and long wavelength is shifted to 408 and 577 nm, respectively. The absorption peak of the PFO-DBT nanorod bundles at short wavelength is redshifted at approximately 20 nm compared to that of the PFO-DBT thin film reported by Wang et al. [4]. The peak at Histone demethylase short wavelength corresponds to the transition of π- π* at fluorene units [4], which indicates that the strong π-π* transition

has occurred via the denser PFO-DBT nanorod bundles. At the long wavelength, the PFO-DBT nanorod bundles that were obtained at the low spin coating rate of 100 rpm were recorded to have an absorption band at 577 nm which was assigned for the DBT units [3]. The maximum peak of 577 nm yields the higher intensity which indicates that the absorption of dioctylfluorene moieties is assisted by the thiophene [18]. The redshift of the absorption peaks is correlated with the morphological distribution of PFO-DBT nanorod bundles. It can be postulated that the highly dense nanorod bundles with close pack arrangement would give a better conjugation length and chain segment. Such improvement in conjugation length can be utilized to enhance the photovoltaic properties of polymeric solar cell. The morphological distribution of the PFO-DBT nanorod bundles has a significant contribution to their optical properties.

Long-distance

races such as single ultra-runs [5, 19] or multiday runs [6, 20] are continuously gaining in popularity all over the world. Especially the 100-km ultra-marathon is one of the most popular distances [21] and therefore, there have already been several studies investigating 100 km runners for changes in body fluid homeostasis [4, 22] and development of oedemata [15]. Bracher et al.[15] concluded in their study that fluid overload was the most likely aetiology for the increase in limb volumes in 100-km ultra-marathoners. Fluid overload was also frequently reported in Ironman triathlons and as the number of participants in Ironman triathlon is rapidly increasing, studies in selleck products this field have become more significant for researchers due to the increasing demand for information [23, 24]. Speedy et al. selleck screening library showed that fluid overload could also occur in Ironman triathletes, leading to EAH [23]. In the 2000 South African Ironman triathlon, Sharwood et al.[25] measured body weight changes, Na+ levels and the performance of the participants. The two major findings were that (i) the percentage change in body

weight was linearly and inversely related to post-race serum [Na+ and (ii) they reasoned that the low incidence of EAH was due to a conservative ON-01910 supplier drinking policy. No study, however, has investigated a potential development of oedemata in the limbs in Ironman triathletes even though they also bear the risk of fluid overload. Therefore, we intended to investigate (i) whether peripheral oedemata occurred in Ironman triathletes and (ii) whether a potential development of peripheral oedemata was due to fluid overload or due to an impaired renal function. The aims of this study were to investigate in male Ironman triathletes Tolmetin (i) a potential increase of both the limb volumes and the thickness of the adipose subcutaneous tissue of both hand and feet

and (ii) in case of an increase in limb volumes and thickness of adipose subcutaneous tissue whether fluid overload or an impairment of renal function was associated with these increases. Fluid overload needs to be distinguished in (i) aggressive drinking at a rate greater than water excretion rate, and (ii) drinking in response to increased osmolality due to the inflammation products of the prolonged exercise. We hypothesized (i) that an Ironman triathlon may lead to an increase of limb volumes or increase the thickness of adipose subcutaneous tissue of the hands and feet as it has been reported for 100-km ultra-marathoners. In case of an increase of limb volumes or thickness of adipose subcutaneous tissue of the hands and feet we hypothesized (ii) that the increase was associated with fluid overload. Methods An observational field study at the ‘IRONMAN SWITZERLAND’ in the 2010 race was used for this research.